|
New England Biolabs
anti reverse cap analog Anti Reverse Cap Analog, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti reverse cap analog/product/New England Biolabs Average 95 stars, based on 1 article reviews
anti reverse cap analog - by Bioz Stars,
2026-04
95/100 stars
|
Buy from Supplier |
|
Thermo Fisher
reverse 3 5 beta 2 microglobuli n b2m gcgctactctctctttctgg gctggatgacgtgagtaaac ribosomal protein s18 s18 accaacatcgatgggcggcg tggtgatcacacgttccacctc Reverse 3 5 Beta 2 Microglobuli N B2m Gcgctactctctctttctgg Gctggatgacgtgagtaaac Ribosomal Protein S18 S18 Accaacatcgatgggcggcg Tggtgatcacacgttccacctc, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse 3 5 beta 2 microglobuli n b2m gcgctactctctctttctgg gctggatgacgtgagtaaac ribosomal protein s18 s18 accaacatcgatgggcggcg tggtgatcacacgttccacctc/product/Thermo Fisher Average 99 stars, based on 1 article reviews
reverse 3 5 beta 2 microglobuli n b2m gcgctactctctctttctgg gctggatgacgtgagtaaac ribosomal protein s18 s18 accaacatcgatgggcggcg tggtgatcacacgttccacctc - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
|
TaKaRa
5 race with smartscribe tm reverse transcriptase kit 5 Race With Smartscribe Tm Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5 race with smartscribe tm reverse transcriptase kit/product/TaKaRa Average 96 stars, based on 1 article reviews
5 race with smartscribe tm reverse transcriptase kit - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
New England Biolabs
5×neb reverse transcription buffer 5×Neb Reverse Transcription Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5×neb reverse transcription buffer/product/New England Biolabs Average 96 stars, based on 1 article reviews
5×neb reverse transcription buffer - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
YMC America
phase ymc triart c18 0 5 Phase Ymc Triart C18 0 5, supplied by YMC America, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phase ymc triart c18 0 5/product/YMC America Average 96 stars, based on 1 article reviews
phase ymc triart c18 0 5 - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Tornier Inc
aequalis reverse shoulder prosthesis (tornier-wright, bloomington, usa) (5) Aequalis Reverse Shoulder Prosthesis (Tornier Wright, Bloomington, Usa) (5), supplied by Tornier Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aequalis reverse shoulder prosthesis (tornier-wright, bloomington, usa) (5)/product/Tornier Inc Average 90 stars, based on 1 article reviews
aequalis reverse shoulder prosthesis (tornier-wright, bloomington, usa) (5) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
reverse primer 5′- cgagccgatcagaccgatgt -3′ Reverse Primer 5′ Cgagccgatcagaccgatgt 3′, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primer 5′- cgagccgatcagaccgatgt -3′/product/Sangon Biotech Average 90 stars, based on 1 article reviews
reverse primer 5′- cgagccgatcagaccgatgt -3′ - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Applied Biological Materials Inc
high-efficiency reverse transcription kit all-in-one 5 × rt mastermix High Efficiency Reverse Transcription Kit All In One 5 × Rt Mastermix, supplied by Applied Biological Materials Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/high-efficiency reverse transcription kit all-in-one 5 × rt mastermix/product/Applied Biological Materials Inc Average 90 stars, based on 1 article reviews
high-efficiency reverse transcription kit all-in-one 5 × rt mastermix - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Amplia Pharmatek
primer pair eco-1 (forward) 5’-gacctgggtttagttcacaga-3’ and eco-2 (reverse) 5’-cacacgctgacgctgacca-3 Primer Pair Eco 1 (Forward) 5’ Gacctgggtttagttcacaga 3’ And Eco 2 (Reverse) 5’ Cacacgctgacgctgacca 3, supplied by Amplia Pharmatek, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer pair eco-1 (forward) 5’-gacctgggtttagttcacaga-3’ and eco-2 (reverse) 5’-cacacgctgacgctgacca-3/product/Amplia Pharmatek Average 90 stars, based on 1 article reviews
primer pair eco-1 (forward) 5’-gacctgggtttagttcacaga-3’ and eco-2 (reverse) 5’-cacacgctgacgctgacca-3 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
New England Biolabs
anti reverse cap analog arca Anti Reverse Cap Analog Arca, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti reverse cap analog arca/product/New England Biolabs Average 95 stars, based on 1 article reviews
anti reverse cap analog arca - by Bioz Stars,
2026-04
95/100 stars
|
Buy from Supplier |